A practical reference on REV-ERB: what it is, how it behaves, what the literature reports, and where the honest uncertainties sit.
This page was last updated on 2026-08-01 and is reviewed periodically as new material appears.
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. It is not an approved medicine and has no established human therapeutic use. The compound appears in scientific literature as a tool for probing circadian and metabolic regulation. Online sellers often label it as a research chemical, sometimes using the nickname Stenabolic. Its chemical identity is distinct from selective androgen receptor modulators, stimulants, and peroxisome proliferator-activated receptor delta agonists. Researchers use it mainly in cell and animal experiments.
At the molecular level, SR9009 binds REV-ERBα and REV-ERBβ and alters their repressive activity on target genes. These nuclear receptors help regulate the circadian clock, lipid synthesis, glucose metabolism, and inflammatory pathways. By changing transcription, the compound can shift the timing or magnitude of downstream metabolic processes in model systems. It does not act through androgen receptors or adenosine receptors, which distinguishes it from several substances sold for athletic performance. Whether the same transcriptional changes occur in humans at tolerable exposures remains an open question because controlled human studies are lacking.
SR9009 is not approved as a medicine by major regulatory agencies. It is commonly sold as a research chemical, a category that may fall outside customary drug approval and quality rules. In sports, the World Anti-Doping Agency lists SR9009 as a prohibited substance. Athletes who use it can face sanctions if it is detected in a sample. Legal status varies by country, and importation may be restricted. Enforcement practices differ across borders.
Detection of SR9009 in biological samples usually employs liquid chromatography coupled with tandem mass spectrometry. This method can identify the parent compound and sometimes metabolites in urine or blood. Because exposure can be low and clearance may be rapid, sample timing and limits of detection matter. Laboratories validate assays for sensitivity and specificity. Results are interpreted alongside chain-of-custody and quality-control records. Urine is the common matrix for anti-doping analysis, while blood may be used in research settings.
Handling recommendations for SR9009 in a laboratory setting include storing the solid at low temperature, protected from light and moisture. The compound is often dissolved in dimethyl sulfoxide or ethanol for experiments. Solutions should be prepared with appropriate personal protective equipment and disposed of according to local rules. Stability data for long-term storage are limited, so stock solutions are typically kept cold and used within defined periods. Records of preparation date and concentration support reproducibility.
| Property | Value | Notes |
|---|---|---|
| Molecular formula | C20H24ClN3O4S | Derived from published structure. |
| Molecular weight | 437.94 g/mol | Calculated value. |
| Appearance | White to off-white solid | Typical for purified research samples. |
| Solubility | DMSO, ethanol; low in water | Class: poorly water-soluble. |
| Typical storage | -20 °C, desiccated, protected from light | Limits degradation. |
SR9009 is a synthetic small molecule studied as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ, also called NR1D1 and NR1D2. These receptors help regulate circadian rhythms and metabolic gene programs. The compound was developed for laboratory research, not as an approved therapeutic. Its identity is distinct from steroid hormones and selective androgen receptor modulators. Scientific interest centers on how REV-ERB activation changes gene expression in cells and animal models.
At the molecular level, SR9009 binds the ligand-binding domain of REV-ERB and strengthens recruitment of corepressor proteins such as NCoR and HDAC3. This increases repression of target genes, including Bmal1 and other clock-controlled and metabolic genes. In rodent studies, such changes have been linked to altered lipid handling, glucose metabolism, and energy expenditure. The precise chain of events between receptor binding and whole-body effects remains an active area of research. Findings in animals do not automatically translate to humans.
Analytical methods for SR9009 typically rely on liquid chromatography coupled with tandem mass spectrometry. The technique can separate the parent compound from related substances and detect low concentrations in biological matrices. Urine and blood are common samples in anti-doping testing, while in vitro studies may use cell culture media. Rapid metabolism and low expected concentrations make method validation important for reliable identification. Exact metabolite patterns can vary by species and are not fully mapped.
Regulatory treatment of SR9009 reflects its investigational status. The compound has no approved human therapeutic indication, and sports authorities prohibit its use. It appears on anti-doping lists as a non-approved substance or metabolic modulator, depending on the list version. Products sold online as research chemicals are not quality-controlled medicines, so their identity and purity can differ from the label. Such products may also contain unlisted compounds, which complicates both testing and safety assessment.
SR9009 is a synthetic small molecule developed as an agonist of the nuclear receptors REV-ERBα (NR1D1) and REV-ERBβ (NR1D2). These receptors help regulate circadian rhythms and metabolic gene expression. In cell and animal studies, SR9009 alters transcription of genes involved in lipid metabolism, inflammation, and mitochondrial function. It is not an approved medicine, and its pharmacological profile in humans remains largely uncharacterized. The compound is frequently discussed in the context of circadian biology and metabolic research rather than clinical use.
Preclinical reports have linked SR9009 to improved endurance and altered energy expenditure in rodents. Such findings have prompted interest in whether REV-ERB activation can influence skeletal muscle metabolism. However, the reported effects depend on dose, route, and experimental model, and replication across laboratories is limited. Human trials have not established comparable outcomes, so claims about exercise performance remain speculative. The absence of controlled human data is a central limitation in interpreting these observations.
Laboratory samples of SR9009 are typically handled as research chemicals rather than pharmaceuticals. Suppliers usually state that the material is for research use only and not for human or veterinary administration. Storage recommendations generally call for a freezer at approximately −20 °C, protection from light, and a desiccated environment. The solid is often described as a white to off-white powder. Solubility is commonly reported in organic solvents such as dimethyl sulfoxide and ethanol, with low solubility in water.
Analytical identification and purity assessment often use high-performance liquid chromatography with ultraviolet detection or mass spectrometry. Liquid chromatography–tandem mass spectrometry is used to detect and quantify SR9009 in biological matrices, including urine and blood, for anti-doping or pharmacokinetic studies. Nuclear magnetic resonance spectroscopy can confirm molecular structure. Stability depends on form and storage: the solid is generally more stable than solutions, and repeated freeze–thaw cycles may degrade samples. Purity is typically reported as a percentage from a certificate of analysis.
The lambda symbol became associated with gay liberation and recognized as an LGBTQ symbol for some time afterwards, being used as such by the International Gay Rights Congress in Edinburgh. Golomb–Dickman constant In continuum mechanics, lambda represents one of the Lamé parameters, which is a material property that arises in stress-strain relationships. λ indicates the wavelength of any wave, especially in physics, electrical engineering, and mathematics.
The statue of Augustus of Prima Porta was discovered within the Villa of Livia in 1863. Little is known about the discovery itself and its immediate aftermath, as the incomplete archaeological journals leave ambiguous evidence for modern historians. The statue was first publicized by the German archaeologist Wilhelm Henzen in 1863 in the Bulletino dell'Instituto di Corrispondenza Archaeologica. The exact location of the statue within the villa is unknown. Suggested sites are the underground complex, a placement near a staircase, the villa's atrium, or in a laurel grove on the southeast corner of Prima Porta hill. Scholars have stated that the last one is relatively unconvincing compared with the first three. The theory that Augustus's statue was found in the underground complex of the villa is based on a hypothesis that Augustus holds a laurel branch instead of a spear in his left hand. Scholars have noted that if this hypothesis is correct, then Villa of Livia must have been decorated with laurel groves and that the reason of the decoration is the omen of the gallina alba (Latin: white hen). Recent excavations have discovered the remnants of pots used to plant laurel on the edge of the Prima Porta hill in front of the underground complex, which Reeder believes suggests the possibility of the existence of laurel groves in the villa and makes it likely that the statue was located in the underground complex.
== Mechanism of action == The detailed mechanism of action for nitrofen, acifluorfen and related diphenyl ether herbicides such as fomesafen was unknown at the time they were invented. The effects visible on whole plants are chlorosis and desiccation: several hypotheses were advanced regarding the molecular-level interactions which might explain these symptoms. The now-accepted explanation for the damage is that these compounds inhibit the enzyme protoporphyrinogen oxidase, which leads to an accumulation of protoporphyrin IX in the plant cells. This is a potent photosensitizer which activates oxygen, leading to lipid peroxidation. Both light and oxygen are required for this process to kill the plant.
Sources: en.wikipedia.org
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
These cells are activated after injury and are required for fibroblast migration during the wound healing process. The Horsley laboratory discovered that aging causes the loss of dermal adipocyte precursor cells regeneration, and therefore requires Pdgf signaling. Furthermore, adipocytes stem cells can form myofibroblasts after skin injury that generate extracellular matrix proteins and crosslink collagen and these cells are stimulated by macrophage-derived signaling proteins. Her research provides a link between the communication of various cells which lead to hair growth and wound healing, revealing a framework for the possible regulation of tissue repair and the development of various diseases. Mechanical forces are known to regulate the development, homeostasis and regeneration of multicellular tissues. To illustrate the mechanics involved in skin function, Horsley with E. Dufresne, used traction force microscopy to discover the physical properties of epithelial cell clusters. Using genetics, function-blocking antibodies and mathematical modeling, their work revealed the significance of physical cohesion through cadherin molecules with the coordination of mechanical force throughout multicellular clusters. Together with M. King, they identified a role of nuclear-cytoskeletal adhesion during the growth of the hair follicle. They found that inner nuclear membrane proteins of the Sun family are required for the process of keratinocyte adhesion and hair follicle structure through regulation of the cytoskeleton.
Multi-photon Raman spectroscopy, such as stimulated Raman spectroscopy (SRS) or coherent anti-Stokes Raman spectroscopy (CARS) help enhance signals from substances in microfluidic devices. A convenient approach for application of SERS-active metal nanoparticles is their embedding in gel-like particles or surface deposition on polymer micro particles. For droplet-based microfluidics, Raman detection provides online analysis of multiple analytes within droplets or continuous phase. Raman signal is sensitive to concentration changes, therefore solubility and mixing kinetics of a droplet-based microfluidic system can be detected using Raman. Considerations include the refractive index difference at the interface of the droplet and continuous phase, as well as between fluid and channel connections.
Sources: en.wikipedia.org
Sunscreens may come in the form of creams, gels or lotions; their SPF number indicates their effectiveness in protecting the skin from the sun's radiation. There are sunscreens available to suit every skin type; in particular, those with oily skin should choose non-comedogenic sunscreens; those with dry skins should choose sunscreens with moisturizers to help keep skin hydrated, and those with sensitive skin should choose unscented, hypoallergenic sunscreen and spot-test in an inconspicuous place (such as the inside of the elbow or behind the ear) to ensure that it does not irritate the skin.
Independent stores will close, leading to massive job losses. Walmart employs very few people in the United States. If allowed to expand in India as much as Walmart has expanded in the United States, few thousand jobs may be created but millions will be lost. Walmart's efficiency at supply chain management leads to direct procurement of goods from the supplier. In addition to eliminating the "middle-man", due to its status as the leading retailer, suppliers of goods are pressured to drop prices in order to assure consistent cash flow. The small retailer and the middle man present in the retail industry play a large part in supporting the local economy, since they typically procure goods and services from the area they have their retail shops in. This leads to increased economic activity, and wealth redistribution. With large, efficient retailers, goods are acquired in other regions, hence reducing the local economy. Walmart may lower prices to dump goods, get competition out of the way, become a monopoly, then raise prices. It is argued this was the case of the soft drinks industry, where Pepsi and Coca-Cola came in and wiped out all the domestic brands. India doesn't need foreign retailers, since homegrown companies and traditional markets have been able to do the job. Work will be done by Indians, profits will go to foreigners. Like the East India Company, Walmart could enter India as a trader and then take over politically. There will be sterile homogeneity and Indian cities will look like cities anywhere else. The government hasn't built consensus.
== Description == The adult lesser mealworm beetle is roughly 6 mm long and widely oval in shape. It is shiny black or brown with reddish brown elytra, the color variable among individuals and changing with age. Much of the body surface is dotted with puncture-like impressions. The antennae are paler at the tips and are covered in tiny, yellowish hairs. The elytra have shallow longitudinal grooves. The eggs are narrow, whitish or tan, and about 1.5 mm long. The larvae somewhat resemble other mealworms, such as the common mealworm (Tenebrio molitor), but are smaller, measuring up to 11 mm long at the final subadult stage. They are tapering and segmented, with three pairs of legs toward the front end, and whitish when newly emerged from the egg and darken to a yellow-brown. They become pale when preparing to molt between instar stages six to 11 instars occur.
Sources: en.wikipedia.org
SR9009 is a synthetic REV-ERB agonist used in laboratory research. It is not an approved drug, and its effects in humans are not well characterized. It is often sold as a research chemical under the name Stenabolic.
No. SR9009 targets the nuclear receptors REV-ERBα and REV-ERBβ, not the androgen receptor. This mechanism differs from selective androgen receptor modulators and from exercise mimetics that act on PPARδ.
Published evidence is mainly preclinical, using cell cultures and animal models. Controlled human trials are not well documented in the public literature. Claims about human performance or health effects therefore remain unsupported by robust clinical data.
Its legal status depends on the country and intended use. It is not an approved medicine in major jurisdictions. In sport, it is prohibited by anti-doping rules.